Microbiome protocol

From TaejoonLab
Jump to: navigation, search

16S rRNA V4-V5(515f-806r) Amplicon with HiSeq/MiSeq

From Caporaso, et al. ISME J (2012)

  • 515fB_fwd (Illumina adapter - GoLay barcode - pad - linker - 515fB primer)
AATGATACGGCGACCACCGAGATCTACACGCT XXXXXXXXXXXX TATGGTAATT GT GTGYCAGCMGCCGCGGTAA
  • 806rB_rev(Illumina adapter - pad - linker - 806rB primer)
CAAGCAGAAGACGGCATACGAGAT AGTCAGTCAG CC GGACTACNVGGGTWTCTAAT
  • Sequencing Primers
 FWD  TATGGTAATT GT GTGYCAGCMGCCGCGGTAA
 REV  AGTCAGTCAG CC GGACTACNVGGGTWTCTAAT
 IDX  AATGATACGGCGACCACCGAGATCTACACGC

PCR condition (total volume 25.0 µL)

  • PCR Grade H2O (note a) 13.0 µL
  • 5 Primer Hot Master Mix (note b) 10.0 µL
  • Forward primer (10µM) 0.5 µL
  • Reverse primer (10µM) 0.5 µL
  • Template DNA 1.0 µL
  • 94°C, 3 min → (94°C, 45 sec → 50°C, 60 sec → 72°C, 90 sec) x 35 times → 72°C, 10 min → 4°C HOLD

16S rRNA V1-V2 Amplicon with MiSeq

From Salipante, et al. AEM (2014)

  • Universal_forward (Illumina adapter - spacer - 16S rRNA target)
AATGATACGGCGACCACCGAGATCTACAC TCTGGTCACGGC AGAGTTTGATC/ideoxyI/TGGCTCAG
  • Barcoded_reverse (Illumina adapter - barcode - spacer - 16S rRNA target)
A1 CAAGCAGAAGACGGCATACGAGAT CAAGGTCA AGTCAGTAATAT CTGCTGCC/ideoxyI/CCCGTAGGAG
B1 CAAGCAGAAGACGGCATACGAGAT GCATAACT AGTCAGTAATAT CTGCTGCC/ideoxyI/CCCGTAGGAG
C1 CAAGCAGAAGACGGCATACGAGAT CTCTGATT AGTCAGTAATAT CTGCTGCC/ideoxyI/CCCGTAGGAG
D1 CAAGCAGAAGACGGCATACGAGAT TACGTACG AGTCAGTAATAT CTGCTGCC/ideoxyI/CCCGTAGGAG
E1 CAAGCAGAAGACGGCATACGAGAT TACGCGTT AGTCAGTAATAT CTGCTGCC/ideoxyI/CCCGTAGGAG
F1 CAAGCAGAAGACGGCATACGAGAT CTCAGTGA AGTCAGTAATAT CTGCTGCC/ideoxyI/CCCGTAGGAG
G1 CAAGCAGAAGACGGCATACGAGAT TCTGATAT AGTCAGTAATAT CTGCTGCC/ideoxyI/CCCGTAGGAG
H1 CAAGCAGAAGACGGCATACGAGAT CATATGCT AGTCAGTAATAT CTGCTGCC/ideoxyI/CCCGTAGGAG
A2 CAAGCAGAAGACGGCATACGAGAT CGTAATTA AGTCAGTAATAT CTGCTGCC/ideoxyI/CCCGTAGGAG
B2 CAAGCAGAAGACGGCATACGAGAT ACGTACTC AGTCAGTAATAT CTGCTGCC/ideoxyI/CCCGTAGGAG
C2 CAAGCAGAAGACGGCATACGAGAT CTTCTAAG AGTCAGTAATAT CTGCTGCC/ideoxyI/CCCGTAGGAG
D2 CAAGCAGAAGACGGCATACGAGAT ACTATGAC AGTCAGTAATAT CTGCTGCC/ideoxyI/CCCGTAGGAG
E2 CAAGCAGAAGACGGCATACGAGAT GACGTTAA AGTCAGTAATAT CTGCTGCC/ideoxyI/CCCGTAGGAG
F2 CAAGCAGAAGACGGCATACGAGAT ACAAGATA AGTCAGTAATAT CTGCTGCC/ideoxyI/CCCGTAGGAG
G2 CAAGCAGAAGACGGCATACGAGAT GACTAAGA AGTCAGTAATAT CTGCTGCC/ideoxyI/CCCGTAGGAG
H2 CAAGCAGAAGACGGCATACGAGAT GTGTCTAC AGTCAGTAATAT CTGCTGCC/ideoxyI/CCCGTAGGAG
A3 CAAGCAGAAGACGGCATACGAGAT TTCACTAG AGTCAGTAATAT CTGCTGCC/ideoxyI/CCCGTAGGAG
B3 CAAGCAGAAGACGGCATACGAGAT AATCGGAT AGTCAGTAATAT CTGCTGCC/ideoxyI/CCCGTAGGAG
  • Illumina_SeqPrimers
Illumina_fwd TCTGGTCACGGCAGAGTTTGATCNTGGCTCAG
Illumina_idx CTCCTACGGGNGGCAGCAGATATTACTGACT
Illumina_rev AGTCAGTAATATCTGCTGCCNCCCGTAGGAG

PCR condition

  • 95°C,10 min → (95°C, 30 sec → 60°C,30 sec → 72°C, 1 min 15 sec) x 28 times → 72°C, 10 min → 4 °C HOLD