CRISPR protocol

From TaejoonLab
Jump to: navigation, search

Courtesy of Michinori Toriyama (originally from the Genome Editing Workshop at National Xenopus Resource, Marine Biological Laboratory)

Direct order of tracer RNA & gRNA from IDT

https://sg.idtdna.com/pages/products/genome-editing/crispr-cas9

  • tracer RNA sequence (cDNA)
>tracer.cDNA
AGCATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTT

Primer design for guide RNA

Heuristic - If your target sequence startsw with GG, use FWD_T7; otherwise, use FWD_SP6.

  • FWD_T7: 5'-TAATACGACTCACTATA[your designed target sequence without PAM]GTTTTAGAGCTAGAAATAGC-3'
  • FWD_SP6: 5'-ATTTAGGTGACACTATA[your designed target sequence without PAM]GTTTTAGAGCTAGAAATAGC-3'
  • REV_universal: 5'-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3'

Minimum promoter sequence of T7 & SP6 (from http://www.sciencegateway.org/protocols/cellbio/appendix/minipro.htm]). Bold G is the +1 base of RNA.

  • T7 - TAATACGACTCACTATAGGGAGA
  • SP6 - ATTTAGGTGACACTATAGAAGNG

CRISPr.png

(Image from XenBase - http://www.xenbase.org/other/static/CRISPr.jsp)

PCR for gRNA template

  1. 90 °C for 30 sec
  2. 90 °C for 10 sec - 62 °C for 20 sec - 72 °C for 20 sec : x10 cycles
  3. 98 °C for 10 sec - 72 °C for 30 sec : x25 cycles
  4. 72 °C for 5 min

The composition of 2x100 μL (two cuts) reaction

FWD primer (100 μM) REV_universal (100 μM) dNTP (10 mM) 5x PCR buffer Phusion Taq pol. Water
1 μL each 2 μL 4 μL 40 μL 1 μL 151 μL (up to 200 μL)

gRNA synthesis by T7 or SP6 MEGAscript

  1. Incubate at 37 °C for 5 hrs.
  2. Treat with 1 μL turboDNase at 37 °C for 15 min.
  3. Purify gRNA by MEGAclear(TM) kit (Ambion AM1908).
  4. Measure the concentration and gRNA quality on agarose gel.

The composition of 20 μL reaction

Template DNA ATP, CTP, GTP, UTP 10x buffer T7 polymerase Water
3 ng 2 μL each 2 μL 2 μL up to 8 μL

Injection to Xenopus embryo

Optimize the concentration of gRNA; the excess amount of gRNA inhibits blastopore closure (and kills embryos).

  1. Dejelly embryo with 3% cysteine with 0.3x MMR (pH 7.9)
  2. Incubate gRNA+Cas9 mixture on ice for > 10 min to form RNA-protein complex
  3. Inject 10 nL of gRNA/Cas9 mixture into animal side at 1 cell stage
  4. Incubate at 18 °C for a while. Check the phenotype.

The composition of 8 μL solution for 10 pL injection (Example)

Cas9 protein (1 μg/μL) 1 μL 1.25 ng per 10 pL injection (1.0 ~ 2.0 ng/ 10 pL)
gRNA-1 (100 μg/μL) 2 μL 250 ng per 10 pL injection
gRNA-2 (100 μg/μL) 2 μL 250 ng per 10 pL injection
memRFP (32 ng/μL) 2 μL 80 pg per 10 pL injection
Water 1 μL
Total Volume 8 μL 800 injections

See also